View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19468_low_2 (Length: 263)

Name: NF19468_low_2
Description: NF19468
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19468_low_2
NF19468_low_2
[»] chr4 (2 HSPs)
chr4 (75-181)||(24347689-24347796)
chr4 (192-224)||(24347644-24347676)


Alignment Details
Target: chr4 (Bit Score: 76; Significance: 3e-35; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 75 - 181
Target Start/End: Complemental strand, 24347796 - 24347689
Alignment:
75 ggatagtggcacctaacagaactccaatatatcctctcaaaagagagttttattcccgttgcggtctta-cttttcaataaattgatcttttacaattat 173  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||| |||||| |  |||||||||||||||||||||||||||    
24347796 ggatagtggcacctaacagaactccaatatatcctctcaaaagagagttttatatccgttgcagtcttaccggttcaataaattgatcttttacaattat 24347697  T
174 gactatga 181  Q
    ||| ||||    
24347696 gacaatga 24347689  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 192 - 224
Target Start/End: Complemental strand, 24347676 - 24347644
Alignment:
192 aagaaaacaactatgaaatatgaaattatttat 224  Q
    ||||||||||| |||||||||||||||||||||    
24347676 aagaaaacaaccatgaaatatgaaattatttat 24347644  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University