View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1946_high_121 (Length: 248)
Name: NF1946_high_121
Description: NF1946
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1946_high_121 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 31 - 238
Target Start/End: Original strand, 44520682 - 44520881
Alignment:
| Q |
31 |
ctggtttccgttccatagatgcaagaactttctcaaattgaagcttgcacgagtggaattgtctctatcaacaattcaagataaaatttgatatgacaag |
130 |
Q |
| |
|
|||||| |||||| |||||||||||||||||||||||||||||| ||||||||| |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
44520682 |
ctggttcccgttctatagatgcaagaactttctcaaattgaagcatgcacgagt--------ctctatcaacaattaaagataaaatttgatatgacaag |
44520773 |
T |
 |
| Q |
131 |
attttagagcatatacaaaggtagtacaaggcacgagctatgggaccatatatatcatacccgattgctttcacaattggtctctttgtaatgaatgatg |
230 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
44520774 |
attttagaacatatacaaaggtagtacaaggcacgagctatgggaccatatatatcatacccgattgctttcacaattgatctctttgtaatgaatgatg |
44520873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University