View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1946_high_153 (Length: 212)
Name: NF1946_high_153
Description: NF1946
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1946_high_153 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 87; Significance: 7e-42; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 87; E-Value: 7e-42
Query Start/End: Original strand, 16 - 198
Target Start/End: Complemental strand, 33904764 - 33904575
Alignment:
| Q |
16 |
tgaagacaacgatgagtgttcttcggagggaatgtaatgtatcttctaggactccaacgctcaagttcaggattt----ctagtgacag---nnnnnnnc |
108 |
Q |
| |
|
||||||||||||||||||||||| | ||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||| | |
|
|
| T |
33904764 |
tgaagacaacgatgagtgttctttgaagggaatttaatgtatcttctaggactccaacgctcaagttcaggatttctagctagtgacagaaaaaaaaaac |
33904665 |
T |
 |
| Q |
109 |
tgttgaggtccaatttttcnnnnnnnnnnnnntgatttctagtgacagacaaaaattgtcattaaatgtcaattgtccgtaggtaaaggt |
198 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33904664 |
tgttgaggtccaatttttcaaaaacaaaaagatgatttctagtgacagacaaaaattgtcattaaatgtcaattgtccgtaggtaaaggt |
33904575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 36; Significance: 0.00000000002; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 151 - 198
Target Start/End: Original strand, 33027380 - 33027427
Alignment:
| Q |
151 |
tgacagacaaaaattgtcattaaatgtcaattgtccgtaggtaaaggt |
198 |
Q |
| |
|
||||||||||||| ||||| ||||| |||||||||||||||||||||| |
|
|
| T |
33027380 |
tgacagacaaaaactgtcactaaatttcaattgtccgtaggtaaaggt |
33027427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 156 - 198
Target Start/End: Original strand, 33031722 - 33031764
Alignment:
| Q |
156 |
gacaaaaattgtcattaaatgtcaattgtccgtaggtaaaggt |
198 |
Q |
| |
|
|||||||| ||||| ||||| |||||||||||||||||||||| |
|
|
| T |
33031722 |
gacaaaaactgtcactaaatttcaattgtccgtaggtaaaggt |
33031764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University