View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1946_high_34 (Length: 439)
Name: NF1946_high_34
Description: NF1946
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1946_high_34 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 198; Significance: 1e-108; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 202
Target Start/End: Original strand, 43968546 - 43968747
Alignment:
| Q |
1 |
ttggtgggaagaaagcctttgtttgttgctgtggctcagcgcaaagaagaaaggaaggctcagttgcaggtgatgctcttctttaacatcatcatgcaca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
43968546 |
ttggtgggaagaaagcctttgtttgttgctgtggctcagcgcaaagaagaaaggaaggctcagttgcaggtgatgctcttctttaacatcattatgcaca |
43968645 |
T |
 |
| Q |
101 |
tatgatctcaatacttacttcattattaagtagctggctggctattgcttataattaatgaatttgctttgattgcctttgttgaaatattcatttttgc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43968646 |
tatgatctcaatacttacttcattattaagtagctggctggctattgcttataattaatgaatttgctttgattgcctttgttgaaatattcatttttgc |
43968745 |
T |
 |
| Q |
201 |
tt |
202 |
Q |
| |
|
|| |
|
|
| T |
43968746 |
tt |
43968747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 163; E-Value: 7e-87
Query Start/End: Original strand, 231 - 422
Target Start/End: Original strand, 43968722 - 43968913
Alignment:
| Q |
231 |
ctttgttgaaatattcatttttgtttataattggtatgttgtatgacttgtatctagnnnnnnnaaatgctcatcttttttgtgtacaagttatttgagt |
330 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
43968722 |
ctttgttgaaatattcatttttgcttataattggtatgttgtatgacttgtatctagtttttttaaatgctcatcttttttgtgtacaagttatttgagt |
43968821 |
T |
 |
| Q |
331 |
tctgctatttgacattcctttctgaatcctcatggttgataaaaattagacataacccgtttccttttaaacatttatttactttcagtttt |
422 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43968822 |
tctgctatttgacattcctttctgaatcctcatggttgataaaaatttgacataacccgtttccttttaaacatttatttactttcagtttt |
43968913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University