View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1946_high_52 (Length: 386)
Name: NF1946_high_52
Description: NF1946
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1946_high_52 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 325; Significance: 0; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 325; E-Value: 0
Query Start/End: Original strand, 32 - 380
Target Start/End: Original strand, 28233170 - 28233518
Alignment:
| Q |
32 |
ccataaggttccataatccgatgaacaagcatttgagagaaccgctggatatcaaatctggaatcacgatcaataaatagaaccaaatgttcaaatccac |
131 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
28233170 |
ccataaggttccataatccgatgaacaagcatttgagaaaaccgctggatatcaaatctggaatcaagatcaataaatagaaccaaatgttcaaatccac |
28233269 |
T |
 |
| Q |
132 |
cgtagtttatcccattccagtctttgggaagaatgcaagtgattgcagtttgaatgaggatttgagttttggcggatggcgaaggaccgacgagttcgag |
231 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28233270 |
cgtagtttatccccttccagtctttgggaagaatgcaagtgattgcagtttgaatgaggatttgagttttggcggatggcgaaggaccgacgagttcgag |
28233369 |
T |
 |
| Q |
232 |
gacgttgccgacgcggagaggaactctgtgaagcggcttagggaggatgaaaggtcggactctccatactcttttcagcatctcgctgccgctttcgtct |
331 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
28233370 |
gacgttgccgacgcggagaggaactctgtgaagcggcttagggaggatgaaaggtcggactctccatactcttttcagcatttcgctgccgctttcgtct |
28233469 |
T |
 |
| Q |
332 |
ccggcaatccagttttggagatgtggtctctcgtgatgattcatctctc |
380 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||| |||| |
|
|
| T |
28233470 |
ccggcaatccagttttggaggtgtggtctctcgtgatgattcatttctc |
28233518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 33
Target Start/End: Original strand, 28233009 - 28233041
Alignment:
| Q |
1 |
tagctttttatcataatctccaccaccttcccc |
33 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
28233009 |
tagctttttatcataatctccaccaccttcccc |
28233041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University