View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1946_high_59 (Length: 370)
Name: NF1946_high_59
Description: NF1946
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1946_high_59 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 153; Significance: 5e-81; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 153; E-Value: 5e-81
Query Start/End: Original strand, 188 - 348
Target Start/End: Complemental strand, 32790516 - 32790356
Alignment:
| Q |
188 |
atacaatcctagatgcgtcaaattcgagctgaaattgatgctgtatccaaagctaatggcgatcgcatgaggaaaccgaagggcgacaggttatttctta |
287 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32790516 |
atacaatcctagatgcgtcaaattcgagctgaaattggtgctgtatccaaagctaatggcgatcgcatgaggaaaccgaagggcgacaggttatttctta |
32790417 |
T |
 |
| Q |
288 |
tttacctgtttaattttccagtctttttgcacgatgttgatatacatacaagtgttcatgt |
348 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32790416 |
tttgcctgtttaattttccagtctttttgcacgatgttgatatacatacaagtgttcatgt |
32790356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 84; E-Value: 8e-40
Query Start/End: Original strand, 1 - 123
Target Start/End: Complemental strand, 32790700 - 32790584
Alignment:
| Q |
1 |
atcgcaaaacaacaatgccttcacaaatttatttgaatttgaaaaccaaaaaatggaatacgtgagcccagaaggacttcgcttggatggtcgcagtcgc |
100 |
Q |
| |
|
|||||||||||||| ||||||||||| ||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
32790700 |
atcgcaaaacaacattgccttcacaattttttttgaatttgaacaccaaaaaatggaatacgtgagcccagaaggacttcgcttggatggtc------gc |
32790607 |
T |
 |
| Q |
101 |
agacccatggaagtaggtactac |
123 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
32790606 |
agacccatggaagtaggtactac |
32790584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 58; Significance: 3e-24; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 248 - 317
Target Start/End: Complemental strand, 48283734 - 48283665
Alignment:
| Q |
248 |
gatcgcatgaggaaaccgaagggcgacaggttatttcttatttacctgtttaattttccagtctttttgc |
317 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
48283734 |
gatcgcatgaggaaaccaaagggcgacaggttatttcttatttacttgtttaatttcccagtctttttgc |
48283665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 191 - 246
Target Start/End: Complemental strand, 48284308 - 48284253
Alignment:
| Q |
191 |
caatcctagatgcgtcaaattcgagctgaaattgatgctgtatccaaagctaatgg |
246 |
Q |
| |
|
|||||||||||||| ||||||||||| || |||| |||||||||||||||| |||| |
|
|
| T |
48284308 |
caatcctagatgcgacaaattcgagcagagattggtgctgtatccaaagctgatgg |
48284253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University