View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1946_high_64 (Length: 363)
Name: NF1946_high_64
Description: NF1946
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1946_high_64 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 50; Significance: 1e-19; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 1 - 78
Target Start/End: Complemental strand, 12185599 - 12185522
Alignment:
| Q |
1 |
ttttgcggcagctcgcctatgtttttgactttgctgtcattgtacaaactctaactgaccttccttaacacaccttat |
78 |
Q |
| |
|
||||||||||| || |||||||||||| |||||||||| |||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
12185599 |
ttttgcggcagttctcctatgtttttggctttgctgtctttgtacaaactctagttgaccttccttaacacatcttat |
12185522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 215 - 247
Target Start/End: Original strand, 25727370 - 25727402
Alignment:
| Q |
215 |
cagaccgttccaataaaattggaggctcggctc |
247 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
25727370 |
cagaccgttccaataaaattggaagctcggctc |
25727402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 219 - 247
Target Start/End: Complemental strand, 14779443 - 14779415
Alignment:
| Q |
219 |
ccgttccaataaaattggaggctcggctc |
247 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
14779443 |
ccgttccaataaaattggaggctcggctc |
14779415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 107 - 143
Target Start/End: Original strand, 30255788 - 30255824
Alignment:
| Q |
107 |
tttatatatctcattttaacttgttataaaaataaaa |
143 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||||||| |
|
|
| T |
30255788 |
tttatatatctcattttagcttgttaaaaaaataaaa |
30255824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University