View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1946_high_72 (Length: 344)
Name: NF1946_high_72
Description: NF1946
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1946_high_72 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 16 - 329
Target Start/End: Original strand, 34744888 - 34745212
Alignment:
| Q |
16 |
ctatctgcagtcattcatattgtttggtgtatttggattgagaggaacaatcggtgttttcaagacaaaattcttcctattgttgaagtgaaatgtagct |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || || |||| ||||||||||||||||| |
|
|
| T |
34744888 |
ctatctgcagtcattcatattgtttggtgtatttggattgagaggaacaatcggtgttttcaagacaacatgct----attgctgaagtgaaatgtagct |
34744983 |
T |
 |
| Q |
116 |
attctttctccactagtgctagtcattcctccgtcactgactatcaggtttcacatctg---------------agagtccctaggccgattatcacctc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| || |
|
|
| T |
34744984 |
attctttctccactagtgctagtcattcctccgtcactgactatcaggtttcacatctgttccttttacctatgagagtccctaggccgattatcacgtc |
34745083 |
T |
 |
| Q |
201 |
tgaagttcgttggattccccccagggaggtgactatatataaaaattaatgttgatggttctgcaattggaaatattgggaatgcctcttctgtgtcact |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34745084 |
tgaagttcgttggattccccccagggaggtgactatatataaaaattaatgttgatggttctgcaattggaaatattgggaatgcctcttctgtgtcact |
34745183 |
T |
 |
| Q |
301 |
gctgaattgtgtgctgctatatatgtttg |
329 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
34745184 |
gctgaattgtgtgctgctatatatgtttg |
34745212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University