View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1946_high_87 (Length: 312)
Name: NF1946_high_87
Description: NF1946
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1946_high_87 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 160; Significance: 3e-85; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 160; E-Value: 3e-85
Query Start/End: Original strand, 141 - 312
Target Start/End: Original strand, 28232832 - 28233002
Alignment:
| Q |
141 |
gcttccataaaatcacaaccgcactatgattttgtcaaactcgcggtaattccaaacatgaagttaaaagattgaaggcagagggaatctacccttctta |
240 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28232832 |
gcttccataaaatcacaacc-cactatgattttgtcaaactcacggtaattccaaacatgaagttaaaagattgaaggcagagggaatctacccttctta |
28232930 |
T |
 |
| Q |
241 |
tcttaccttgagagtctgaagaaactgaaaactgtcggaacaacgaacatacaaaaatcgagacatacacaa |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28232931 |
tcttaccttgagagtctgaagaaactgaaaactgtcggaacaacgaacatacaaaaatcgagacatacacaa |
28233002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 94; E-Value: 7e-46
Query Start/End: Original strand, 34 - 131
Target Start/End: Original strand, 28232703 - 28232800
Alignment:
| Q |
34 |
aagaaatttgattttcaaaatttagtattagagaatctaatttaacaccaagttagggcatgtttgggttgcgggttaatttgatggaatcaatgtgt |
131 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28232703 |
aagaaatttgattttcaaaatttagtattagagaatctaatttaacaccaagttagtgcatgtttgggttgcgggttaatttgatggaatcaatgtgt |
28232800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University