View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1946_high_94 (Length: 305)
Name: NF1946_high_94
Description: NF1946
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1946_high_94 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 270; Significance: 1e-151; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 22 - 295
Target Start/End: Original strand, 41105146 - 41105419
Alignment:
| Q |
22 |
ttgaatccagaagaagtgttataaagcatcactatgtcgattctctataatcttttgaagttcttgaggcttacatggcaatgcaatagcacccttttgt |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41105146 |
ttgaatccagaagaagtgttataaagcatcactatgtcgattctctataatcttttgaagttcttgaggcttacatggcaatgcaatagcacccttttgt |
41105245 |
T |
 |
| Q |
122 |
tgataaccatactcatccttagcttgctccaatagtttcatgaaatgaggatttgttaagtaatccaactcaagaacaaatctctttgtttcttcacctt |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41105246 |
tgataaccatactcatccttagcttgctccaatagtttcatgaaatgaggatttcttaagtaatccaactcaagaacaaatctctttgtttcttcacctt |
41105345 |
T |
 |
| Q |
222 |
gcattgcaataaccgcaaaaaacccttcaggaacagttgtttctgtttcactctcttcatcatcaatgtctctg |
295 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41105346 |
gcattgcaataaccgcaaaaaacccttcaggaacagttgtttctgtttcactctcttcatcatcaatgtctctg |
41105419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University