View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1946_low_103 (Length: 298)
Name: NF1946_low_103
Description: NF1946
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1946_low_103 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 122; Significance: 1e-62; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 1 - 157
Target Start/End: Original strand, 48966838 - 48966988
Alignment:
| Q |
1 |
attacattcttattttattcttctcaaccaaagcaaattaagccacttctctatcttatttgctttatgatgtttagcaaaagctataaacaagttcatc |
100 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48966838 |
attacattcttattttattcttctcaagcaaagcaaattaagccacttctctatcttatttgctttatgatgtttagcaaaagctataaacaagttcatc |
48966937 |
T |
 |
| Q |
101 |
accatgggcatggaggaagaagagcaacaaagatttaaagtacctgtgaattacctc |
157 |
Q |
| |
|
|| |||||||||||||||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
48966938 |
ac------catggaggaagaagagcaacaaagttttacagtacctgtgaattacctc |
48966988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 195 - 290
Target Start/End: Original strand, 48967085 - 48967180
Alignment:
| Q |
195 |
ttcttcaatacattatgattcatattcataattataagtcccagctccaataccaacatcatctaaatcttgttggctgcttcagagcttcatctc |
290 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48967085 |
ttcttcaacacattatgattcatattcataattataagtcccagctccaataccaacatcatctaaatcttgttggctgcttcagagcttcatctc |
48967180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University