View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1946_low_104 (Length: 298)
Name: NF1946_low_104
Description: NF1946
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1946_low_104 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 19 - 273
Target Start/End: Complemental strand, 40305553 - 40305299
Alignment:
| Q |
19 |
aggagggtgggtggttatgttatagtcggggagtaaggtcagtttcgtggcagaaatttaatttgattcgtgacgatgtaggattggaaaatgggagcta |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||| |||||||||||| |
|
|
| T |
40305553 |
aggagggtgggtggttatgttatagtcggggagtaaggtcagtttcgtggcaaaaatttaatttgatttgtgacgatgtaggattgggaaatgggagcta |
40305454 |
T |
 |
| Q |
119 |
gttggttgataatttaggttaggtggtggctcatgactcctctatgnnnnnnnngacgtgacccttggatggtcggatgctcgtttaatgtaagatttag |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40305453 |
gttggttgataatttaggttaggtggtggctcatgactcctctatgttttttttgacgtgacccttggatggtcggatgctcgtttaatgtaagatttag |
40305354 |
T |
 |
| Q |
219 |
aaggttgtacgagttagttgcgatcaaattggtgagatggcgggtatgttctctt |
273 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
40305353 |
aaggttgtacgagttagttgcgatcaaattggtgagatggcaggtatgttctctt |
40305299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University