View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1946_low_113 (Length: 272)
Name: NF1946_low_113
Description: NF1946
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1946_low_113 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 1 - 258
Target Start/End: Complemental strand, 47038829 - 47038562
Alignment:
| Q |
1 |
ttttaattatccgccgtgatttatatcacgannnnnnnagtagaccacacatgagtttcttnnnnnnnnnnnnnttgcaatttattcttcattcttcata |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
47038829 |
ttttaattatccgccgtgatttatatcacgatttttttagtagaccacacatgagtttctttatatatatatatttgcaatttattcttcattcttcata |
47038730 |
T |
|
| Q |
101 |
taaatagaacaaatccatctgaattttcagactcttcct---------agttttggca-cattgagacacaatatatatggtacagcaaagcgaatcaac |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47038729 |
taaatagaacaaatccatctgaattttcagactcttcctgaactatatagttttggcaacattgagacacaatatatatggtacagcaaagcgaatcaac |
47038630 |
T |
|
| Q |
191 |
taggaggatcatggaagaagaaagagattgttgttcaacaataataagaaacatagaaagcaacaaca |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47038629 |
taggaggatcatggaagaagaaagagattgttgttcaacaataataagaaacatagaaagcaacaaca |
47038562 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University