View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1946_low_117 (Length: 252)
Name: NF1946_low_117
Description: NF1946
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1946_low_117 |
 |  |
|
| [»] chr6 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 85; Significance: 1e-40; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 164 - 252
Target Start/End: Original strand, 4327438 - 4327526
Alignment:
| Q |
164 |
tgtctattttttaatgttcaagtaacacaaccgttcacagggtttttagtcaatttttagagtcattttagagatattgtagctagttt |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4327438 |
tgtctattttttaatgttcaagtaacacaaccgctcacagggtttttagtcaatttttagagtcattttagagatattgtagctagttt |
4327526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 13 - 113
Target Start/End: Original strand, 4327289 - 4327387
Alignment:
| Q |
13 |
aatatagtcagtaggttaacgacacacatcaagttttaaagactaaacaccagtcatttaactttcgtgtatatttatgaaattatgtgtaagtcgtaga |
112 |
Q |
| |
|
||||||||||||||||||| || |||||||||||||||||||||||||| | |||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
4327289 |
aatatagtcagtaggttaaagatacacatcaagttttaaagactaaaca-ctgtcatttaactttcgtgtatatttatgaaa-tatgtgtaagtcgtaga |
4327386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University