View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1946_low_123 (Length: 249)
Name: NF1946_low_123
Description: NF1946
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1946_low_123 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 16 - 249
Target Start/End: Complemental strand, 36761378 - 36761144
Alignment:
| Q |
16 |
atgtcaaattaaaactagaactaacctag-cccccctcctccacttgagatcaggcagggatgcaaggttgggtcaaagggtcggctgacgagacttact |
114 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| || ||| ||||||||||||||||||||||| |
|
|
| T |
36761378 |
atgtcaaattaaaactagaactaacctagtcccccctcctccacttgagatcaggcagggatgcaaggtcggatcagagggtcggctgacgagacttact |
36761279 |
T |
|
| Q |
115 |
tattgtattttttaataaatacttaaatgtttatgcaatgtgaccccacttatataatacttttgttttcaacatgcaccacttcaacaactatgcattc |
214 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36761278 |
tattgtattttttaataaatacttagatgtttatgcaatgtgaccccacttatataatacttttgttttcaacatgcaccacttcaacaactatgcattc |
36761179 |
T |
|
| Q |
215 |
aacgtgttcatacatatgttcaaattgaacatcat |
249 |
Q |
| |
|
||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
36761178 |
aacatgttcatacatatgttcaacttgaacatcat |
36761144 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 123 - 169
Target Start/End: Original strand, 43129811 - 43129857
Alignment:
| Q |
123 |
tttttaataaatacttaaatgtttatgcaatgtgaccccacttatat |
169 |
Q |
| |
|
||||||| ||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
43129811 |
tttttaaccaatacttaaatatttatgcaatgtgaccccacttatat |
43129857 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 122 - 158
Target Start/End: Complemental strand, 37206859 - 37206823
Alignment:
| Q |
122 |
ttttttaataaatacttaaatgtttatgcaatgtgac |
158 |
Q |
| |
|
||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
37206859 |
ttttttaataaatacttaaatatttatgcaacgtgac |
37206823 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University