View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1946_low_133 (Length: 245)

Name: NF1946_low_133
Description: NF1946
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1946_low_133
NF1946_low_133
[»] chr5 (2 HSPs)
chr5 (14-125)||(42463504-42463615)
chr5 (173-245)||(42463663-42463735)


Alignment Details
Target: chr5 (Bit Score: 96; Significance: 3e-47; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 14 - 125
Target Start/End: Original strand, 42463504 - 42463615
Alignment:
14 gtgttagtgttcgtgttgggtccagtatccgtgcttcatagctacattgtaattgctatcagaagaaaataatttttggtttctcttgtagattgaattg 113  Q
    |||||||||||||||||| ||||||||||||||||||||||||| | |||||||| ||||||||||||||||||||||||||||||||||||||||||||    
42463504 gtgttagtgttcgtgttgtgtccagtatccgtgcttcatagctataatgtaattgttatcagaagaaaataatttttggtttctcttgtagattgaattg 42463603  T
114 aaatatgtgaaa 125  Q
    ||||||||||||    
42463604 aaatatgtgaaa 42463615  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 173 - 245
Target Start/End: Original strand, 42463663 - 42463735
Alignment:
173 gtgactgaagtgtaatgaaaatgtgattattcattcagagtgtacttggcattatacttggaggtggtgctgg 245  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42463663 gtgactgaagtgtaatgaaaatgtgattattcattcagagtgtacttggcattatacttggaggtggtgctgg 42463735  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University