View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1946_low_133 (Length: 245)
Name: NF1946_low_133
Description: NF1946
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1946_low_133 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 96; Significance: 3e-47; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 14 - 125
Target Start/End: Original strand, 42463504 - 42463615
Alignment:
| Q |
14 |
gtgttagtgttcgtgttgggtccagtatccgtgcttcatagctacattgtaattgctatcagaagaaaataatttttggtttctcttgtagattgaattg |
113 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||| | |||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42463504 |
gtgttagtgttcgtgttgtgtccagtatccgtgcttcatagctataatgtaattgttatcagaagaaaataatttttggtttctcttgtagattgaattg |
42463603 |
T |
 |
| Q |
114 |
aaatatgtgaaa |
125 |
Q |
| |
|
|||||||||||| |
|
|
| T |
42463604 |
aaatatgtgaaa |
42463615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 173 - 245
Target Start/End: Original strand, 42463663 - 42463735
Alignment:
| Q |
173 |
gtgactgaagtgtaatgaaaatgtgattattcattcagagtgtacttggcattatacttggaggtggtgctgg |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42463663 |
gtgactgaagtgtaatgaaaatgtgattattcattcagagtgtacttggcattatacttggaggtggtgctgg |
42463735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University