View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1946_low_14 (Length: 553)
Name: NF1946_low_14
Description: NF1946
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1946_low_14 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 98; Significance: 5e-48; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 98; E-Value: 5e-48
Query Start/End: Original strand, 298 - 466
Target Start/End: Complemental strand, 29643575 - 29643413
Alignment:
| Q |
298 |
atatactgcaactaaataattaatgtataaaatagctcgattttccctatnnnnnnnnnnnnttaatgtataaaatagtgcgatttaaatttcagatttg |
397 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||| | ||||||||||||||||||||||||||||||||| || |
|
|
| T |
29643575 |
atatactgcaactaaataattaatgtataaaatagcgtgattttccct------taaaaaaatgaatgtataaaatagtgcgatttaaatttcagatatg |
29643482 |
T |
|
| Q |
398 |
gctaaacggcctatcggttcagacatgagcttccattgccttcttcttgggttcgtcactcaagattca |
466 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||| |
|
|
| T |
29643481 |
gctaaacggcctatcggttcagacatgagcttgcattgccttcttcttgggttcgtcacccaagattca |
29643413 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 87; E-Value: 2e-41
Query Start/End: Original strand, 18 - 112
Target Start/End: Complemental strand, 29643887 - 29643793
Alignment:
| Q |
18 |
aaagcaaacatgagagtaaaagtgtcttttatcaaccattgaatcaaatacaagtgcaaattaaaactcttattttagtgactcatgtgccttaa |
112 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29643887 |
aaagcaaacatgagagtaaaagtgccttttatcaaccattgaatcaaatacaagttcaaattaaaactcttattttagtgactcatgtgccttaa |
29643793 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 81; E-Value: 7e-38
Query Start/End: Original strand, 166 - 281
Target Start/End: Complemental strand, 29643739 - 29643621
Alignment:
| Q |
166 |
gtctccgttctttacagcaaacatgtttacaattccatc---acttggttcctcaccagggtcgtcccttataaaatgcaaacagttgtactgagttgga |
262 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
29643739 |
gtctccgttctttacagcaaacatgtttacaattccatctgcacttggttcctcaccagggccgtcccttacgggatgcaaacagttgtactgagttgga |
29643640 |
T |
|
| Q |
263 |
cctctaaaatttggaggtc |
281 |
Q |
| |
|
|||| |||||||||||||| |
|
|
| T |
29643639 |
cctccaaaatttggaggtc |
29643621 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University