View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1946_low_141 (Length: 239)
Name: NF1946_low_141
Description: NF1946
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1946_low_141 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 32538590 - 32538368
Alignment:
| Q |
1 |
tgatgaatt-atatttgcacttgcatacacatgatatcaaatttacacacacaaaaatatcaccttactccctaaaacggaattagtatagatattatat |
99 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||| |||||| |
|
|
| T |
32538590 |
tgatgaattgatatttgcacttgcatacacatgatatcaaatttacacacacaaaaatatcaccttactccttaaaacggaattagcatagatgttatat |
32538491 |
T |
 |
| Q |
100 |
acttgaatagatgttatatcagtacaacttcttatgttcgtagggcaagtcgaattcacacttttatcttgtataagtaaactcccgaccaattcaacaa |
199 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32538490 |
acttgaatagatgttatattagtacaacttcttatgtaggtagggcaagtcgaattcacacttttatcttgtataagtaaactcccgaccaattcaacaa |
32538391 |
T |
 |
| Q |
200 |
acctcttagttatatatagatgt |
222 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
32538390 |
acctcttagttatatatagatgt |
32538368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University