View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1946_low_159 (Length: 217)
Name: NF1946_low_159
Description: NF1946
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1946_low_159 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 202
Target Start/End: Original strand, 37345432 - 37345633
Alignment:
| Q |
1 |
aattaccaatccgaggaaagtggttggacttcttactttgaagatttctctaaaggcattgaaccaagttactgttcttcaagtttaggtggttcctctt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37345432 |
aattaccaatccgaggaaagtggttggacttcttactttgaagatttctctaaagacattgaaccaagttactgttcttcaagtttaggtggttcctctt |
37345531 |
T |
 |
| Q |
101 |
tggtctcagatgctgcttcttgtgctgcatggaaattttcacataaaaatcatgttagaagttcaccaaacctctctaagaaactctctttgaagaaatc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37345532 |
tggtctcagatgctgcttcttgtgctgcatggaaattttcacataaaaatcatgttagaaattcaccaaacctctctaagaaactctctttgaagaaatc |
37345631 |
T |
 |
| Q |
201 |
aa |
202 |
Q |
| |
|
|| |
|
|
| T |
37345632 |
aa |
37345633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 49; Significance: 3e-19; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 16 - 140
Target Start/End: Complemental strand, 16735630 - 16735512
Alignment:
| Q |
16 |
gaaagtggttggacttcttactttgaagatttctctaaaggcattgaaccaagttactgttcttcaagtttaggtggttcctctttggtctcagatgctg |
115 |
Q |
| |
|
|||||||| ||||| |||||||||| |||||||| ||||| || ||||||||||| |||||| || |||||||| |||||| | |||||||||| |
|
|
| T |
16735630 |
gaaagtggatggacaacttactttgatgatttctcaaaaggtatagaaccaagttattgttctg---gt---ggtggttcttctttgctttcagatgctg |
16735537 |
T |
 |
| Q |
116 |
cttcttgtgctgcatggaaattttc |
140 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
16735536 |
cttcttgtgctgcatggaaattttc |
16735512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University