View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1946_low_160 (Length: 216)
Name: NF1946_low_160
Description: NF1946
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1946_low_160 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 146; Significance: 4e-77; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 146; E-Value: 4e-77
Query Start/End: Original strand, 19 - 216
Target Start/End: Complemental strand, 4327709 - 4327512
Alignment:
| Q |
19 |
ctcaccagaacggctatgatgactatgccacaagcatcataggtgataaaattgtaaaaagcatatcagttacatagttatctagttcatgtggatttca |
118 |
Q |
| |
|
|||||||||||| || ||||| |||||||||||||||||| ||||||||| |||||||||||||| |||||||| || |||||||||| ||||||||||| |
|
|
| T |
4327709 |
ctcaccagaacgtctgtgatggctatgccacaagcatcatcggtgataaacttgtaaaaagcatagcagttacagagctatctagttcctgtggatttca |
4327610 |
T |
 |
| Q |
119 |
atggcttcaaggctttttagcttcttttgttctctcatggttttttgatagatttcgttacaaaactcatctaaaacaatcataaactagctacaata |
216 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
4327609 |
atggcttcaagactttttagcttcttttgttctctcatggttttttgaacgatttcgttacaaaactcgtctaaaacaatcataaactagctacaata |
4327512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University