View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1946_low_165 (Length: 208)
Name: NF1946_low_165
Description: NF1946
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1946_low_165 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 29 - 149
Target Start/End: Original strand, 37936817 - 37936937
Alignment:
| Q |
29 |
aatcataggcatacaaaaggtagaaagcatattgatacccacgatgcttcatattaagaaaaatattaaattgattaaaaatgattaactacctactaac |
128 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37936817 |
aatcataggcatacaaaaggcagaaagcatatcgatacccacgatgcttcatattaagaaaaatattaaattgattaaaaatgattaactacctactaac |
37936916 |
T |
 |
| Q |
129 |
aaccactaactgacttgtaag |
149 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
37936917 |
aaccactaactgacttgtaag |
37936937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University