View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1946_low_168 (Length: 202)
Name: NF1946_low_168
Description: NF1946
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1946_low_168 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 164; Significance: 7e-88; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 164; E-Value: 7e-88
Query Start/End: Original strand, 12 - 195
Target Start/End: Original strand, 44728273 - 44728456
Alignment:
| Q |
12 |
gaaatgaaaataatagaaagtagaaaggatcctaacctcggattttaggtctatatcattatgtcatgtgattctcaaaatcattactaaaattatagcc |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
44728273 |
gaaatgaaaataatagaaagtagaaaggatcctaacctcagattttaggtctatatcattatgtgatgtgattctcaaaatcattactaaaattatagcc |
44728372 |
T |
|
| Q |
112 |
aacggaattaaaacccagcttcctatgattgacaatttcaaaatgcttttattcctaaaaggatatgcttatcattgatgatgt |
195 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
44728373 |
aacagaattaaaacccagcttcctatgattgacaatttcaaaatgcttttattcctaaaaggctatgcttatcattgataatgt |
44728456 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University