View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1946_low_38 (Length: 437)
Name: NF1946_low_38
Description: NF1946
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1946_low_38 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 197; Significance: 1e-107; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 16 - 273
Target Start/End: Original strand, 51466337 - 51466593
Alignment:
| Q |
16 |
actataacaacaccatgcctcacactaggttttccccaggcttgagaagctgcaaaaatacagtaannnnnnnnatgttagaatggatcattatttggca |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
51466337 |
actataacaacaccatgcctcacactaggttttccccaggcttgagaagctgcaaaaatacagtaaatttttt-atgttagaatgaatcattatttggca |
51466435 |
T |
 |
| Q |
116 |
taccattaaaaataagtggtaaaggtcaaggttaagtgttactttttatatcgttttttatcggggcatagaattatttgatatgacgtgttttaaataa |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51466436 |
taccattaaaaataagtggtaaaggtcaaggttaagttttactttttatatctttttttatcggggcatagaattatttgatatgacgtgttttaaataa |
51466535 |
T |
 |
| Q |
216 |
gttttaagaaaattttattacaactagtgtcatgacgcgcacgatcatttatattgac |
273 |
Q |
| |
|
||||||||||||||||||||||||||| |||| || | ||| |||||||||||||||| |
|
|
| T |
51466536 |
gttttaagaaaattttattacaactagagtcaagaggagcatgatcatttatattgac |
51466593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 378 - 417
Target Start/End: Original strand, 51466698 - 51466737
Alignment:
| Q |
378 |
acggtatgcaatattgtttctattgtcgtggatcgttcca |
417 |
Q |
| |
|
||||||| ||||||||||||||||||||| |||||||||| |
|
|
| T |
51466698 |
acggtatccaatattgtttctattgtcgtagatcgttcca |
51466737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University