View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1946_low_39 (Length: 436)
Name: NF1946_low_39
Description: NF1946
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1946_low_39 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 252; Significance: 1e-140; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 4 - 268
Target Start/End: Complemental strand, 51328820 - 51328554
Alignment:
| Q |
4 |
ataatactgatttgttttccaccggaaaattatacaattgaaaagatctttcactcatcatgatttgttttgttggtattaagaaaaaa--tggatttga |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
51328820 |
ataatactgatttgttttccaccggaaaattatataattgaaaagatctttcactcatcatgatttgttttgttggtattaagaaaaaaaatggatttga |
51328721 |
T |
|
| Q |
102 |
attaactaccgtcacaatcccacgcattatcacattcaacacaattgaacggtttagaaagcaaataggttttgatttttgttttaactaaaaaatactg |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51328720 |
attaactaccgtcacaatcccacgcattatcacattcaacacaattgaacggtttagaaagcaaataggttttgatttttgttttaactaaaaaatactg |
51328621 |
T |
|
| Q |
202 |
agtttgaaatttggacggtccgatctcgatgcagcgatcacttatatgttgttaattgcgtgaattc |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51328620 |
agtttgaaatttggacggtccgatctcgatgcagcgatcacttatatgttgttaattgcgtgaattc |
51328554 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 341 - 415
Target Start/End: Complemental strand, 51328489 - 51328415
Alignment:
| Q |
341 |
ttccaactcaacaaagaaacaataggtctgtctgtttctttggttcaatatattagggacccccaaacaaacatg |
415 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51328489 |
ttccaactcaacaaagaaacaataggtctgtctgtttctttggttcaatatattagggacccccaaacaaacatg |
51328415 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University