View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1946_low_47 (Length: 415)
Name: NF1946_low_47
Description: NF1946
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1946_low_47 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 303; Significance: 1e-170; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 303; E-Value: 1e-170
Query Start/End: Original strand, 12 - 341
Target Start/End: Original strand, 42760473 - 42760803
Alignment:
| Q |
12 |
atgagatataaactgggaggaagattaccatgatcattttttgaactagttcacaaatgtcaaccattaactcttcaagattatatgtgagtagtttaga |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||| |
|
|
| T |
42760473 |
atgagatataaactgggaggaagattaccatgatcattttttgaactagttcacaaatgtcaaccataaactcttcaagattatatgtgaatagtttaga |
42760572 |
T |
 |
| Q |
112 |
accaaacaatttcttctcttccaacaaacataattctaaatttt-gatcaacttcgaaaaacattgtatctcttttctagaacctctcacttctaattgg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
42760573 |
accaaacaatttcttctcttccaacaaacataattctaaatttttgatcaacttcgaaaaacattgcatctcttttctagaacctctcacttctaattgg |
42760672 |
T |
 |
| Q |
211 |
tgcatactctcttgcttatttgtgcaacacgagtgacattatccttgtctggcttgtctcggtctttcaacaacaaaagcacgtgtcttattgaaacata |
310 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||| |
|
|
| T |
42760673 |
tgcatactctcttgcttatttgtgcaacacgagtgacattatccttgtctggcttgtctcggtctttcaacaacaaaagcatgtgtcttagtgaaacata |
42760772 |
T |
 |
| Q |
311 |
tatcggttttgctaaatcttcaacattcttc |
341 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
42760773 |
tatcggttttgctaaatcttcaacattcttc |
42760803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University