View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1946_low_88 (Length: 318)
Name: NF1946_low_88
Description: NF1946
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1946_low_88 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 40 - 304
Target Start/End: Original strand, 45676998 - 45677261
Alignment:
| Q |
40 |
gctaattgttttggtggaaaaggtttatcgttgaattttataatttatgttccaattctgatgcgagtaaaagaaaattacattaactatggtattggta |
139 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
45676998 |
gctaattgttttggtggaaaaggtttatcgttgaattttataatttatgttccaattctgatgcgagtaaaagaaaattacatgaactatggtattggta |
45677097 |
T |
 |
| Q |
140 |
caaattggatttgagccatggtatggtgttaagctctcaagtctcaaccatttatactatttgcacattgctgaaaatttgctttaatgtcttacctatc |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
45677098 |
caaattggatttgagccatggtatggtgttaagctttcaagtctcaaccatttatactatttgcacattgctgaaaatttgttttaatgtcttacctatc |
45677197 |
T |
 |
| Q |
240 |
agtataacaatatttcaggtaaagaatattgtaaaacaacaaattaagcttctgatgaaaattct |
304 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
45677198 |
agtataacaatatttcaggtaaagaatattgtaaaacaac-aattaagcttctgatgaaaattct |
45677261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University