View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1946_low_98 (Length: 304)
Name: NF1946_low_98
Description: NF1946
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1946_low_98 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 18 - 294
Target Start/End: Original strand, 50519954 - 50520234
Alignment:
| Q |
18 |
gttcgtcaatgacaaattcaacaatctggtttcgcgactgcttaaaaattgcnnnnnnngaagggaaaatgtatacctacatcttatgtcagggcttcta |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50519954 |
gttcgtcaatgacaaattcaacaatctggtttcgcgactgcttaaaaattgcaaaaaaagaagggaaaatgtatacctacatcttatgtcagggcttcta |
50520053 |
T |
|
| Q |
118 |
taatctataatctttacattttcagctgagggtatgattatagtttatgttcaatttctaaattctaattgatgaattattgttgctccttgcgatccca |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||| |
|
|
| T |
50520054 |
taatctataatctttacattttcagctgagggtatgattatagtttatgttcaatttctaaattctaattgatgaattattgttactccttgtgatccca |
50520153 |
T |
|
| Q |
218 |
attacagtttcactacagtagaatcatgtaggaatactacatgcagcaggtc----tatggacatgtatttggaattattt |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
50520154 |
attacagtttcactacagtagaatcatgtaggaatactacatgcagcaggtctatatatggacatgtatttggaattattt |
50520234 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University