View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19470_high_19 (Length: 270)
Name: NF19470_high_19
Description: NF19470
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19470_high_19 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 1 - 260
Target Start/End: Original strand, 13030335 - 13030594
Alignment:
| Q |
1 |
tatagtttcttggcgaattggtggatttgaatgtctgtggcatatagtggtgatttagttgaagattaatttagatacaagtagtgaaaaagtgatggca |
100 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13030335 |
tatagtttcttggcgaattggtgaatttgaatgtctgtggcatatagtggtgatttagttgaagattaatttagatacaagtagtgaaaaagtgatggca |
13030434 |
T |
 |
| Q |
101 |
gcagagtcaaatactggttttcattatggtgatatgaattcatcgttgaattggcatgcaatatcatttgaatctggtggtgttgttagtagcttgcctg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13030435 |
gcagagtcaaatactggttttcattatggtgatatgaattcatcgttgaattggcatgcaatatcatttgaatctggtggtgttgttagtagcttgcctg |
13030534 |
T |
 |
| Q |
201 |
agatggttccaatgggaaattattttgggttgaacaatgatacttctgggatgatgatgt |
260 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
13030535 |
agatggttccaatgggaaattattttgggttgaacaatgatacagctgggatgatgatgt |
13030594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University