View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19470_high_3 (Length: 474)
Name: NF19470_high_3
Description: NF19470
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19470_high_3 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 263; Significance: 1e-146; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 263; E-Value: 1e-146
Query Start/End: Original strand, 130 - 459
Target Start/End: Original strand, 42593596 - 42593919
Alignment:
| Q |
130 |
aatatgcaaggttcgaaccccggccaccacaacaacatagaaaacgttggtaaataaccaaaaataaagggaagaggttttagtaggtggtttagtaaaa |
229 |
Q |
| |
|
|||||||||||||||||||||||||| | || || |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
42593596 |
aatatgcaaggttcgaaccccggccaaaaaaaaaa------aaacgttggtaaataaccaaaaataaagggaagaggttttagtagggtgtttagtaaaa |
42593689 |
T |
|
| Q |
230 |
gcaaccgggaagtgagaacagcaaaacttgataaatacgaaagaagggatagaaatagggtttcgcttgcacagaattcccaggtcacgaaaatggctaa |
329 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42593690 |
gcaaccgggaagtgagaacaacaaaacttgataaacacgaaagaagggatagaaatagggtttcgcttgcacagaattcccaggtcacgaaaatggctaa |
42593789 |
T |
|
| Q |
330 |
cattttgaaacctaattcagccagaatcgcactgcgtgctatcccccgcccgttcgcggcagcggcggcatcagctacaccagcatccatcgcctctcga |
429 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||| |
|
|
| T |
42593790 |
cattttgaaacctaattcagctagaatcgcactgcgtgctatcccccgcccgttcgcggcagcggcggcatcagctacaccagcatccatcccctcccga |
42593889 |
T |
|
| Q |
430 |
ttctcctcagttcgctgtatttgttgtttt |
459 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
42593890 |
ttctcctcagttcgctgtatttgttgtttt |
42593919 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 200 - 275
Target Start/End: Original strand, 42576756 - 42576830
Alignment:
| Q |
200 |
gaagaggttttagtaggtggtttagtaaaagcaaccgggaagtgagaacagcaaaacttgataaatacgaaagaag |
275 |
Q |
| |
|
||||| ||||||||||| ||||||| ||||||||||||||| |||||||| |||||||| | || |||||||||| |
|
|
| T |
42576756 |
gaagatgttttagtagg-ggtttagaaaaagcaaccgggaattgagaacaaaaaaacttgtttaacacgaaagaag |
42576830 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000007; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 121 - 161
Target Start/End: Complemental strand, 124479 - 124439
Alignment:
| Q |
121 |
aatgcatagaatatgcaaggttcgaaccccggccaccacaa |
161 |
Q |
| |
|
|||||||| |||||||||||||| ||||| ||||||||||| |
|
|
| T |
124479 |
aatgcataaaatatgcaaggttcaaaccctggccaccacaa |
124439 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University