View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19470_low_11 (Length: 348)
Name: NF19470_low_11
Description: NF19470
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19470_low_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 287; Significance: 1e-161; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 287; E-Value: 1e-161
Query Start/End: Original strand, 17 - 326
Target Start/End: Complemental strand, 24308677 - 24308367
Alignment:
| Q |
17 |
caacatgggccaagtaggttatcagatccatctgctgataattgcgggattttggattctacatttgtagctgcaacctgcacattgaatcatgtataga |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24308677 |
caacatgggccaagtaggttatcagatccatctgctgataattgcgggattttggattctacatttgtagctgcaacctgcacattgaatcatgtataga |
24308578 |
T |
 |
| Q |
117 |
agaaaaagacctttgttggacgtcagcagtgttccatctatgtgcgaatgaggcctt-aatcagggatccctatcagcaaactcgttagttgcagcaaaa |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24308577 |
agaaaaagacctttgttggacgtcagcagtgttccatctatgtgcgaatgaggccttgaatcagggatccctatcagcaaactcgttagttgcagcaaaa |
24308478 |
T |
 |
| Q |
216 |
gatgattcccctggtccatatgggattggttgtgggcgaggtcggttaatagctggtttccgacattttggtgtgcaataccttgcaacatatccctcat |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||| |||||||| ||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
24308477 |
gatgattcccctggtccatatgggattggttgtgggtgaggtcagttaatagttggtttccgacattttgttgtgcaataccttgcaacatatccctcat |
24308378 |
T |
 |
| Q |
316 |
ctatggttttg |
326 |
Q |
| |
|
||||||||||| |
|
|
| T |
24308377 |
ctatggttttg |
24308367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University