View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19470_low_16 (Length: 292)
Name: NF19470_low_16
Description: NF19470
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19470_low_16 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 13 - 275
Target Start/End: Original strand, 28030144 - 28030406
Alignment:
| Q |
13 |
catcaaagcttttaaccggcggcaatgctcttattgcacacctagcaatctctgcaatcgtgccgaaagacatattgatctgctgtaaatcaactatgta |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28030144 |
catcaaagcttttaaccggcggcaatgctcttattgcacacctagcaatctctgcaatcgtgccgaaagacatattgatctgctgtaaatcaactatgta |
28030243 |
T |
|
| Q |
113 |
atgtcccctttccctcatagaccatgcattatttctattttctctcatagacaatgcaatattattttgtgcaagagattcaaaaaattctctcctttca |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28030244 |
atgtcccctttccctcatagaccatgcattatttctattttccctcatagacaatgcaatattattttgtgcaagagattcaaaaaattctctcctttca |
28030343 |
T |
|
| Q |
213 |
tataactgttgtatttggaccgtctcaacaaaactattatccatttttccatattctctaaag |
275 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28030344 |
tataactgttgtatttggaccgtctcaacaaaactattatccatttttccatattctctaaag |
28030406 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University