View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19470_low_5 (Length: 448)

Name: NF19470_low_5
Description: NF19470
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19470_low_5
NF19470_low_5
[»] chr4 (1 HSPs)
chr4 (1-176)||(20070230-20070405)


Alignment Details
Target: chr4 (Bit Score: 148; Significance: 6e-78; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 148; E-Value: 6e-78
Query Start/End: Original strand, 1 - 176
Target Start/End: Complemental strand, 20070405 - 20070230
Alignment:
1 taagtttcccttggtaggcattttattttacatccactgtttggagtactaaatctcccagtttaaagtcagtcatatgggatcaccttatagttgtagt 100  Q
    |||||| |||||||||| |||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
20070405 taagttccccttggtagacattgttttttacatccactgtttggagtactaaatctcccagtttaaagtcagtcatatgggatccccttatagttgtagt 20070306  T
101 gggctttaacatgtcgtttaaccagatctacttataccgataccacttatactttcacccctacaaaccattgaaa 176  Q
    |||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
20070305 gggctttaacatttcgtttaaccagatctacttataccgataccacttatactttaacccctacaaaccattgaaa 20070230  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University