View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19470_low_5 (Length: 448)
Name: NF19470_low_5
Description: NF19470
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19470_low_5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 148; Significance: 6e-78; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 148; E-Value: 6e-78
Query Start/End: Original strand, 1 - 176
Target Start/End: Complemental strand, 20070405 - 20070230
Alignment:
| Q |
1 |
taagtttcccttggtaggcattttattttacatccactgtttggagtactaaatctcccagtttaaagtcagtcatatgggatcaccttatagttgtagt |
100 |
Q |
| |
|
|||||| |||||||||| |||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
20070405 |
taagttccccttggtagacattgttttttacatccactgtttggagtactaaatctcccagtttaaagtcagtcatatgggatccccttatagttgtagt |
20070306 |
T |
|
| Q |
101 |
gggctttaacatgtcgtttaaccagatctacttataccgataccacttatactttcacccctacaaaccattgaaa |
176 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
20070305 |
gggctttaacatttcgtttaaccagatctacttataccgataccacttatactttaacccctacaaaccattgaaa |
20070230 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University