View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19472_high_3 (Length: 291)
Name: NF19472_high_3
Description: NF19472
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19472_high_3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 118; Significance: 3e-60; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 64 - 189
Target Start/End: Complemental strand, 43392973 - 43392848
Alignment:
| Q |
64 |
tcgaatagaaagaaaccaaaccacgtttgtttgatttttggttttcaatttcgaaaatctaataaacccatgaaccaaactaatttaacttagtccagtc |
163 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43392973 |
tcgaatagaaagaaaccaaaccacgcttgtttgatttttggttttcaatttcgaaaatctaataaacccatgaaccaaactaatttaacttagtccagtc |
43392874 |
T |
 |
| Q |
164 |
tcaacattttaccatcattatcaccc |
189 |
Q |
| |
|
|||||||||||||||| ||||||||| |
|
|
| T |
43392873 |
tcaacattttaccatcgttatcaccc |
43392848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University