View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19473_high_12 (Length: 328)
Name: NF19473_high_12
Description: NF19473
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19473_high_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 147; Significance: 2e-77; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 147; E-Value: 2e-77
Query Start/End: Original strand, 7 - 161
Target Start/End: Original strand, 1746430 - 1746584
Alignment:
| Q |
7 |
tagataatactctctcaagaaccactctaaaaataagtctccactgatgaccactcacaagatggcggcttaccattggcaaatgacctaattttctgat |
106 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1746430 |
tagataatactctctcaagcaccactctaaaaataagtctccactgatgaccactcacaagatggcggcttaccattggcaaatgacctaattttctgat |
1746529 |
T |
 |
| Q |
107 |
ggtgggcagtcgatgtgtccattgaaataatagttaaatatttagcagccctaat |
161 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1746530 |
ggtgggcagtcgatgtatccattgaaataatagttaaatatttagcagccctaat |
1746584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 250 - 310
Target Start/End: Original strand, 1746634 - 1746694
Alignment:
| Q |
250 |
tctctaaattcattcattgttatggttacttgttttgcaagaaaagaatagctgcgctaat |
310 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
1746634 |
tctctaaattcattcattgttatggttacttgttttgcaagaaaacaatagctgcgctaat |
1746694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 76 - 148
Target Start/End: Original strand, 1724853 - 1724929
Alignment:
| Q |
76 |
ttaccattggcaaatgacctaattttctgatggtgggca----gtcgatgtgtccattgaaataatagttaaatatt |
148 |
Q |
| |
|
|||||| |||||||| |||||| ||||||| |||||||| ||| || |||| |||||||||||||||||||||| |
|
|
| T |
1724853 |
ttaccactggcaaattacctaagtttctgacggtgggcaaatagtcaatatgtcaattgaaataatagttaaatatt |
1724929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University