View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19473_high_20 (Length: 211)
Name: NF19473_high_20
Description: NF19473
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19473_high_20 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 191; Significance: 1e-104; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 195
Target Start/End: Complemental strand, 11903592 - 11903398
Alignment:
| Q |
1 |
cgcttgaccgaggtggatttaaagggattgtgtttgtcaatatctcaagaagcagcagaagcagcaacagaaacagttaatagtaacatgaagaatgtca |
100 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11903592 |
cgcttgatcgaggtggatttaaagggattgtgtttgtcaatatctcaagaagcagcagaagcagcaacagaaacagttaatagtaacatgaagaatgtca |
11903493 |
T |
|
| Q |
101 |
aaagaaattttgagaaaattaccatggttggcagagaaaatgaaaagaaggagattatagatcaactactgaagttgaacaaccctgctgatgat |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11903492 |
aaagaaattttgagaaaattaccatggttggcagagaaaatgaaaagaaggagattatagatcaactactgaagttgaacaaccctgctgatgat |
11903398 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 127 - 182
Target Start/End: Original strand, 11859049 - 11859104
Alignment:
| Q |
127 |
gttggcagagaaaatgaaaagaaggagattatagatcaactactgaagttgaacaa |
182 |
Q |
| |
|
||||||||||||| || |||||||||||||||||| |||| |||||| ||||||| |
|
|
| T |
11859049 |
gttggcagagaaagagagaagaaggagattatagataaactgctgaagatgaacaa |
11859104 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 109 - 175
Target Start/End: Original strand, 11730274 - 11730340
Alignment:
| Q |
109 |
tttgagaaaattaccatggttggcagagaaaatgaaaagaaggagattatagatcaactactgaagt |
175 |
Q |
| |
|
||||||||| |||| ||||||| |||||| |||| ||||| ||||||||||||| |||||| |||| |
|
|
| T |
11730274 |
tttgagaaagttactgtggttggaagagaatatgagaagaaagagattatagatcgactacttaagt |
11730340 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University