View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19474_high_11 (Length: 212)

Name: NF19474_high_11
Description: NF19474
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19474_high_11
NF19474_high_11
[»] chr7 (1 HSPs)
chr7 (18-193)||(46892426-46892601)


Alignment Details
Target: chr7 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 18 - 193
Target Start/End: Original strand, 46892426 - 46892601
Alignment:
18 ttctcaatcactcttccctattgcacttcttaccaactcatccgtccacgtcatcatgtactcttactacttcctcaccaccgttggtatccgaccgcct 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
46892426 ttctcaatcactcttccctattgcacttcttaccaactcatccgtccacgtcatcatgtactcttactacttcctcaccaccgttggaatccgaccgcct 46892525  T
118 tggaaacgcgtcgttaccgactgccagattgttcagttcgtgttcagcttcgccgtctccggtctcatgctttatt 193  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46892526 tggaaacgcgtcgttaccgactgccagattgttcagttcgtgttcagcttcgccgtctccggtctcatgctttatt 46892601  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University