View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19474_low_10 (Length: 235)
Name: NF19474_low_10
Description: NF19474
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19474_low_10 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 212
Target Start/End: Complemental strand, 46892449 - 46892238
Alignment:
| Q |
1 |
gcaatagggaagagtgattgagaagaattaagccatagataacacatgactgggacggttgaatgatggtacacgtggaggaatgagaggcgtttgatgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46892449 |
gcaatagggaagagtgattgagaagaattaagccatagataacacatgactgggacggttgaatgatggtacacgtggaggaatgagaggcgtttgatgg |
46892350 |
T |
|
| Q |
101 |
atcttgataggattatgaagagagtgtcaatgaattcaagatattttgagaggtagaagatgtaggcccaaaagaagaggggaccatttggaggggtatg |
200 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46892349 |
atcttgataggatgatgaagagagtgtcaatgaattcaagatattttgagaggtagaagatgtaggcccaaaagaagaggggaccatttggaggggtatg |
46892250 |
T |
|
| Q |
201 |
aggagggaaaca |
212 |
Q |
| |
|
|||||||||||| |
|
|
| T |
46892249 |
aggagggaaaca |
46892238 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University