View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19474_low_11 (Length: 230)
Name: NF19474_low_11
Description: NF19474
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19474_low_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 1 - 209
Target Start/End: Complemental strand, 24349233 - 24349025
Alignment:
| Q |
1 |
gcagtctgtttaccggacgtgctaaattagttacatgagatggatgtttacagggttaccattgaactagaatgtaaaccagtgacggatgaaatctatg |
100 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||| |
|
|
| T |
24349233 |
gcagtctgtttaccggacgtgctaaaatagttacatgagatggatgtttacagggttaccattgaactagaatgtaaaccaatggcggatgaaatctatg |
24349134 |
T |
 |
| Q |
101 |
gagattatacttatgcaattgattttcgctctataagaaacccgtcaacttttaaatcaaaactataagattagtttttactagaagaaatttttaatca |
200 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||| ||||||||| |
|
|
| T |
24349133 |
gagattatacttatgcaattgactttcgctctataagaaacccgttaacttttaaatcaaaactataagattagtttttaccagaagaaacttttaatca |
24349034 |
T |
 |
| Q |
201 |
aatacatcg |
209 |
Q |
| |
|
||||||||| |
|
|
| T |
24349033 |
aatacatcg |
24349025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University