View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19475_high_38 (Length: 399)
Name: NF19475_high_38
Description: NF19475
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19475_high_38 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 311; Significance: 1e-175; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 311; E-Value: 1e-175
Query Start/End: Original strand, 17 - 382
Target Start/End: Complemental strand, 32528349 - 32527986
Alignment:
| Q |
17 |
agatgaatgtttgtccattgttatttcagaactctggcggttacgtcagtggttttggnnnnnnnnnnccccatctaggtaggttcagtttgaaatcttt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
32528349 |
agatgaatgtttgtccattgttatttcagaactctggcggttacgtcagtggttttggaagaaaaa--ccccatctaggtaggttcagtttgaaatcttt |
32528252 |
T |
 |
| Q |
117 |
agtttgtggttgtatttcttgcctctgatttctggttctttccaaatctacaactttcaaggcgtttggtttattgccaaccacaatggtggttttgtgt |
216 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32528251 |
agtttgtggctgtatttcttgcctctgatttctggttctttccagatctacaactttcaaggcgtttggtttattgccaaccacaatggtggttttgtgt |
32528152 |
T |
 |
| Q |
217 |
ctgttaatatttgatggtgttctttcatgtgttgtcgttttactatttatggtgctcagatttgtcgatccctcattttggatatgcgattggttatcgg |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
32528151 |
ctgttaatatttgatggtgttctttcatgtgtcgtcgttttactatttatggtgctcagatttgtcgatccctcattttggatatgtgattggttatcgg |
32528052 |
T |
 |
| Q |
317 |
tcattttatgtatcaagaccttttcacttccgtgattcttagttatggttttgtttggctcgaaag |
382 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32528051 |
tcattttatgtatcaagaccttttcgcttccgtgattcttagttatggttttgtttggctcgaaag |
32527986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University