View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19475_high_56 (Length: 333)
Name: NF19475_high_56
Description: NF19475
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19475_high_56 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 283; Significance: 1e-158; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 283; E-Value: 1e-158
Query Start/End: Original strand, 19 - 312
Target Start/End: Original strand, 45683971 - 45684265
Alignment:
| Q |
19 |
gatagaacatgcatatttgaccctcactgcgacctttttctgaaaattaccaaa-ccgaagggtatatgtaattctagtatatgtaatgagtctggcttt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45683971 |
gatagaacatgcatatttgaccctcactgcgacctttttctgaaaattaccaaaaccgaagggtatatgtaattctagtatatgtaatgagtctggcttt |
45684070 |
T |
 |
| Q |
118 |
ttcaataatgaatttccaaacctgatgttttgattctaaaacagatgcaagttgtagatttaaagagcaccgaagggcccactatgatgaattccttcaa |
217 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45684071 |
ttcaataatgaattaccaaacctgatgttttgattctaaaacagatgcaagttgtagatttaaagagcaccgaagggcccactatgatgaattccttcaa |
45684170 |
T |
 |
| Q |
218 |
gttaaagaactgagaaagcaggctgctcttctagagaatggaagtgacaaggagaataatcgtaataccgtgcttgctgaggagaagaaatccga |
312 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45684171 |
gttaaagaactgagaaagcaggctgctcttctagagaatggaagtgacaaggagaataatcgtaataccgtgcttgctgaggagaagaaatccga |
45684265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University