View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19475_high_72 (Length: 250)
Name: NF19475_high_72
Description: NF19475
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19475_high_72 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 215; Significance: 1e-118; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 9 - 223
Target Start/End: Original strand, 45514503 - 45514717
Alignment:
| Q |
9 |
gaagaatatgctgttgtttgcttcgttccgaacggccactgcagcgcttgcatctagctccgctgtgttcacaaatccaatgttttgagccatgaaccct |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45514503 |
gaagaatatgctgttgtttgcttcgttccgaacggccactgcagcgcttgcatctagctccgctgtgttcacaaatccaatgttttgagccatgaaccct |
45514602 |
T |
|
| Q |
109 |
tctccacgaatgtctgcattcacacacattctcatcaatatttatgagtttagttgagtttcaaatatttgcataagaaacattacaaattatttcaaat |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45514603 |
tctccacgaatgtctgcattcacacacattctcatcaatatttatgagtttagttgagtttcaaatatttgcataagaaacattacaaattatttcaaat |
45514702 |
T |
|
| Q |
209 |
taatcactgtgtgtc |
223 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
45514703 |
taatcactgtgtgtc |
45514717 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 217 - 249
Target Start/End: Original strand, 45515657 - 45515689
Alignment:
| Q |
217 |
gtgtgtctactaggcaagatttttccagatgta |
249 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |
|
|
| T |
45515657 |
gtgtgcctactaggcaagatttttccagatgta |
45515689 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 45; Significance: 9e-17; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 12 - 116
Target Start/End: Original strand, 43699704 - 43699808
Alignment:
| Q |
12 |
gaatatgctgttgtttgcttcgttccgaacggccactgcagcgcttgcatctagctccgctgtgttcacaaatccaatgttttgagccatgaacccttct |
111 |
Q |
| |
|
|||||| || |||||||| ||||| |||||||||| ||||| | ||||||| | |||||| ||||||||||||||||| |||||| |||| ||||||| |
|
|
| T |
43699704 |
gaatatactattgtttgcctcgtttcgaacggccattgcaggacctgcatctgtccccgctgagttcacaaatccaatgtcttgagctatgagcccttct |
43699803 |
T |
|
| Q |
112 |
ccacg |
116 |
Q |
| |
|
||||| |
|
|
| T |
43699804 |
ccacg |
43699808 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University