View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19475_high_82 (Length: 237)
Name: NF19475_high_82
Description: NF19475
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19475_high_82 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 30233569 - 30233347
Alignment:
| Q |
1 |
tgtatggcagttgccgttatgtatgcaaactccaggagcccattgttccaccaatttgaagtagtcgtagtaatatgcttcactaccatcacaacacagg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
30233569 |
tgtatggcagttgccgttatgtatgcaaactcctggagcccattgttccaccaatttaaagtagtcgtaataatatgcttcactaccatcacagcacagg |
30233470 |
T |
|
| Q |
101 |
aagaaaacggcggaaataataaaaatccagtagatactggaaatccnnnnnnnatttgttaaccgttgtggcttctcaccatcctttgccttgccaccca |
200 |
Q |
| |
|
||||||| |||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30233469 |
aagaaaatggcggaaataataaaaatcctgtagatactggaaatcctttttctgtttgttaaccgttgtggcttctcaccatcctttgccttgccaccca |
30233370 |
T |
|
| Q |
201 |
acgtcttcatcttctttggatgt |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
30233369 |
acgtcttcatcttctttggatgt |
30233347 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University