View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19475_low_36 (Length: 414)
Name: NF19475_low_36
Description: NF19475
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19475_low_36 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 234; Significance: 1e-129; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 108 - 407
Target Start/End: Original strand, 3242102 - 3242413
Alignment:
| Q |
108 |
gaagaattgccatagccttaggtactatcttctatattgttggtgtatatatccaactgttttttatggcaattttgattttataatatctgatacgaaa |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3242102 |
gaagaattgccatagccttaggtactatcttctatattgttgatgtatatatccaactgttttttatggcaattttgattttataatatctgatacgaaa |
3242201 |
T |
 |
| Q |
208 |
acatatgttttgctaatagctatggtgttgataattttttaagttggtaaaactatttttcgtcacc-----ttgcatatgaactttaggtttaaagctt |
302 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||| || |
|
|
| T |
3242202 |
acatatgttttgctaatggctatggtgttgataattttttaagttggtaaaactatttttcgtcaccgatgtttgaatatgaactttaggtttaaagttt |
3242301 |
T |
 |
| Q |
303 |
gaaaatttatatgcaagtggatcaaaatgacctaaaaaga-------gatcaaatccttatccgaaattaagtttagtccactatagtagttttgcatgc |
395 |
Q |
| |
|
||||||| ||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
3242302 |
gaaaattcatatgcaagcggatcaaaatgacctaaaaagagataaatgatcaaatccttatccgaaattaagttaagtccactatagtagttttgcatgc |
3242401 |
T |
 |
| Q |
396 |
gtatattcttcg |
407 |
Q |
| |
|
||||||| |||| |
|
|
| T |
3242402 |
gtatattattcg |
3242413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 16 - 44
Target Start/End: Original strand, 3242010 - 3242038
Alignment:
| Q |
16 |
tcttgaacacatgtttatgcattgttttc |
44 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
3242010 |
tcttgaacacatgtttatgcattgttttc |
3242038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University