View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19475_low_45 (Length: 364)
Name: NF19475_low_45
Description: NF19475
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19475_low_45 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 152; Significance: 2e-80; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 129 - 345
Target Start/End: Complemental strand, 7682662 - 7682447
Alignment:
| Q |
129 |
aacataaccgaaaagataaaattatcaagaatcatctaaagtttatctgagcaaacaaata---tgaagagtgttctacagaccaggaggatctagacga |
225 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| ||||||||||| |||||| |||| | | ||| || |||||||||||||||||||||||| |
|
|
| T |
7682662 |
aacataaccgaaaagataaaattatcaaaaatcacctaaagtttat---agcaaaaaaatcacctaatgaggatt-tacagaccaggaggatctagacga |
7682567 |
T |
 |
| Q |
226 |
attacccaaaaaccactttcaatatgagaattggacatgatccaccaattgttcactctcgacattaattattagaggaatggcagcattttgattcttc |
325 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7682566 |
attacccaaaaaccactttcaatatgagaattggacatgatccaccaattgttcactctcgacattaattattagaggaatggcagcattttgattcttc |
7682467 |
T |
 |
| Q |
326 |
caagagccaaccctacatgc |
345 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
7682466 |
caagagccaaccctacatgc |
7682447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University