View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19475_low_61 (Length: 280)
Name: NF19475_low_61
Description: NF19475
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19475_low_61 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 159; Significance: 1e-84; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 159; E-Value: 1e-84
Query Start/End: Original strand, 1 - 175
Target Start/End: Complemental strand, 7966719 - 7966545
Alignment:
| Q |
1 |
taggaagaagcttttgggtcatgtgattgggactgttgaagataacccgcctacaaaacaaccattgattttggctttactcatgctacaattagcacaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
7966719 |
taggaagaagcttttgggtcatgtgattgggactgttgaagataacccgcttacaaaacaaccattgatgttggttttactcatgctacaattagcacaa |
7966620 |
T |
|
| Q |
101 |
atggtagcttcttgtttttctacaatgtaagggatgatcaatcattttaatatcagtttaaatggtatcgtgagt |
175 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
7966619 |
atggtagcttcttgtttttctacaatgtaagggatgatcaatcattttaatttcagtttaaatggtatcgtgagt |
7966545 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 193 - 270
Target Start/End: Complemental strand, 7966343 - 7966268
Alignment:
| Q |
193 |
catgcagttttcataataaagaaaaaacttttcccacacattgaaattcttacccactcctgtgtggaccaacctatg |
270 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
7966343 |
catgcagttttcataataaagaaaaaacttttcccaca--ttgaaattcttacccactcttgtgtggaccaacctatg |
7966268 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University