View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19475_low_62 (Length: 278)
Name: NF19475_low_62
Description: NF19475
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19475_low_62 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 139; Significance: 9e-73; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 139; E-Value: 9e-73
Query Start/End: Original strand, 106 - 260
Target Start/End: Original strand, 30965663 - 30965817
Alignment:
| Q |
106 |
acagagtgagagtctgaatcaatttttctatgttaattagcaagactattttatcatgttgaccactttcacttttttcatgtcacaaatattttactgt |
205 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30965663 |
acagagtgagagtctgaatccatttttctatgttaattaacaagactattttatcatgttgaccactttcacttttttcatgtcacaaatattttactgt |
30965762 |
T |
 |
| Q |
206 |
ttgcatgaatatgaaagaattaacgtttcatgatgtcagtgaatgaaggaatatt |
260 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
30965763 |
ttgcatgaatatgaaagaattaatgtttcatgatgtcaatgaatgaaggaatatt |
30965817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University