View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19475_low_63 (Length: 276)
Name: NF19475_low_63
Description: NF19475
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19475_low_63 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 125; Significance: 2e-64; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 136 - 264
Target Start/End: Complemental strand, 40530764 - 40530636
Alignment:
| Q |
136 |
tgagtttataccttatagtgaagcttgtatgattaaatttcatcacatctcatttgttccattaataaaacttattaatccaatgatgaaagggtcgcca |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
40530764 |
tgagtttataccttatagtgaagcttgtatgattaaatttcatcacatctcatttgttccattaataaaacttattaatccaatgatgaaagggtcgtca |
40530665 |
T |
 |
| Q |
236 |
aaggataagccactaaatgtctcataatt |
264 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
40530664 |
aaggataagccactaaatgtctcataatt |
40530636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 1 - 82
Target Start/End: Complemental strand, 40530851 - 40530770
Alignment:
| Q |
1 |
tgttcaatcacttataaagatggtcggcctctgcactcacccttgatttgatacatatnnnnnnnttgtctgatatgcatat |
82 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
40530851 |
tgttcgatcacttataaagatggtcggcctctgctctcacccttgatttgatacatataaaaaaattgtctgatatgcatat |
40530770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University