View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19475_low_67 (Length: 259)
Name: NF19475_low_67
Description: NF19475
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19475_low_67 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 15 - 251
Target Start/End: Original strand, 7095243 - 7095479
Alignment:
| Q |
15 |
ctttctctatgattcatatttgttaacaattacacatggagatagaattactacactattattgtgaatgaaaagaaaacaagtttgtgcctttcccatt |
114 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7095243 |
ctttctctatgattcatttttgttaacaattacacatggatatagaattaccacactattattgtgaatgaaaagaaaacaagtttgtgcctttcccatt |
7095342 |
T |
|
| Q |
115 |
ttatcttcaccatgttttatccctttgtatgggtcctaaacaacatgggttgcccgtgatatgggaccacaacaactcacaagatccaaatctaatccac |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
7095343 |
ttatcttcaccatgttttatccctttgtatgggtcctaaacaacatgggttgcccgtgatatgggaccacaacaattcacaagatccaaatctaatccac |
7095442 |
T |
|
| Q |
215 |
gggtttctttttaggtcactaatcaatccttcttctc |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7095443 |
gggtttctttttaggtcactaatcaatccttcttctc |
7095479 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University