View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19475_low_79 (Length: 243)
Name: NF19475_low_79
Description: NF19475
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19475_low_79 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 10 - 227
Target Start/End: Original strand, 51967812 - 51968029
Alignment:
| Q |
10 |
gcagagagggcaaacaagggtagcatggttgcgtacatgtgctgctatgcaagggaaatgaaaagcatgtgcacattctgctgtgtatattgccttaccc |
109 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
51967812 |
gcagacagggcaaacaagggtagcatggttgcgtacatgtgctgctatgcaagggaaatgaaaagcatgtgcacattctgctgtgtatattgccttcccc |
51967911 |
T |
 |
| Q |
110 |
tgccctgttttcacgctattcaaacagattccacagctactctgaatcaaacaataatatcaaaataaataaggcagatcagtatcattatttggatctc |
209 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51967912 |
tgccccgttttcacgctattcaaacagattccacagctactctgaatcaaacaataatatcaaaataaataaggcagatcagtatcattatttggatctc |
51968011 |
T |
 |
| Q |
210 |
aataacataggaaaaaag |
227 |
Q |
| |
|
||||| |||||||||||| |
|
|
| T |
51968012 |
aataaaataggaaaaaag |
51968029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University