View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19475_low_85 (Length: 233)
Name: NF19475_low_85
Description: NF19475
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19475_low_85 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 159; Significance: 8e-85; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 18 - 192
Target Start/End: Complemental strand, 13853905 - 13853731
Alignment:
| Q |
18 |
gaacatagagcttaaataaagacagtttgattttacttgacgttttgtcacacataagtacttatatgataagcgtcaatgctataagtgtcgagttaag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13853905 |
gaacatagagcttaaataaagacagtttgattttacttgacgttttgttatacataagtacttatatgataagcgtcaatgctataagtgtcgagttaag |
13853806 |
T |
|
| Q |
118 |
ttctttatgcaaataaggtcactgccaaaggttttagcttttggaattgaatccaattggggtgttgtggatata |
192 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
13853805 |
ttctttatgcaaacaaggtcactgccaaaggttttagcttttggaattgaatccatttggggtgttgtggatata |
13853731 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 69 - 107
Target Start/End: Complemental strand, 24193529 - 24193491
Alignment:
| Q |
69 |
acataagtacttatatgataagcgtcaatgctataagtg |
107 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
24193529 |
acataagtacttatatgataagcgtttatgctataagtg |
24193491 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University